Tmem192 molecular weight
WebDisclosed herein are methods and compositions for modulating MFSD12 expression and activity to treat diseases such as lysosomal storage diseases, including cystinosis. Also disclosed are methods of altering skin pigmentation and methods of screening for MFSD12 modulation agents. WebThe serine/threonine kinase mTOR participates in growth factor signaling as a component of two multi-subunit complexes, mTORC1 and mTORC2. mTORC1 associates with lysosomes, and its activity depends on the positioning of lysosomes within the cytoplasm, although there is no consensus regarding the exact effect of perinuclear versus peripheral …
Tmem192 molecular weight
Did you know?
WebJan 8, 2024 · TMEM192 transmembrane protein 192 Gene ID: 202431, updated on 18-May-2024 Gene type: protein coding See all available tests in GTR for this gene Go to complete … WebTMEM192 Promoter ubc Tag / Fusion Protein Flag (C terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site AgeI (not destroyed) 3′ cloning site EcorI (not destroyed) 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA (Common Sequencing Primers) Resource Information Articles Citing this Plasmid 3 References
WebJun 1, 2010 · Molecular characterisation of ‘transmembrane protein 192’ (TMEM192), a novel protein of the lysosomal membrane Schröder, Bernd; Wrocklage, Christian; Hasilik, Andrej; Saftig, Paul Biological Chemistry, Volume 391 (6) – Jun 1, 2010 Read Article Download PDF Share Full Text for Free 10 pages Article Details Recommended … WebApr 21, 2024 · Additionally, the rapid timeframe of the TMEM192-tagged Lyso-IP method allows potentially labile molecules, such as amino acids and other metabolites, to remain stable for downstream MS analysis. Lysosomes isolated by the Lyso-IP method have been successfully used for proteomic, lipidomic, and metabolomic analyses [ 22, 26, 27 ].
WebJul 4, 2024 · TMEM192 exhibits four transmembrane segments with cytosolic N- and C-termini and forms homodimers. Devoid of significant homologies, the molecular function … WebBackbone size w/o insert (bp) 8143. Total vector size (bp) 8956. Modifications to backbone. The original EGFP was removed, and Tmem192-mRFP-3xHA was inserted at NheI and …
Web1 involving Tmem192. Incidental Mutations. Mutagenetix , APF , CvDC. Find Mice (IMSR) 15 strains or lines available. Mice homozygous for a knock-put allele are viable and overtly …
WebTMEM192 (Transmembrane Protein 192), located on 4q32.3, is a Protein Coding gene. The gene produces a 30922 Da protein composed of 271 amino acids. ... Schröder B, et al. (2010) Molecular characterisation of 'transmembrane protein 192' (tmem192), a novel protein of the lysosomal membrane. Biol Chem 391 (6): 695-704. sainsbury motor insurance loginWebAll lanes : Anti-TMEM192 antibody [EPR14330-67] (ab186737) at 1/10000 dilution Lane 1 : U87-MG cell lysate Lane 2 : Human fetal liver lysate Lane 3 : Human fetal lung lysate Lysates/proteins at 20 µg per lane. Secondary All … thiel v southern pacific co rulingWebAug 13, 2024 · f INS-1E cells were co-transfected with LATS2-Myc and Tmem192-3xHA or Tmem192-2xFlag plasmids for 48 h. One set of cells were treated with 50 µM CQ for last 4 h. One set of cells were treated ... sainsbury mugs and cupsWebMar 1, 2003 · Molecular Function: protein homodimerization activity Source:UniProtKB. 1 publication. Expand table. Complete GO annotation on QuickGO ... Protein family/group … sainsbury mulled wineWebObserved molecular weight: 30 kDa: GenBank accession number: BC036301: Gene symbol: TMEM192: Gene ID (NCBI) 202431: Conjugate: Unconjugated: Form: Liquid: Purification Method: Antigen affinity purification: Storage Buffer: PBS with 0.02% sodium azide and … sainsbury muffinsWebDec 1, 2024 · A prepared sunscreen containing low molecular weight lignin (F5, <1000 g/mol) exhibits good UV-protecting property (sun protection factor (SPF) = 7.14) and light color advantages (ΔE = 46.2). Lignin has great potential as a natural, green, and sustainable broad-spectrum sunscreen active ingredient. However, the coexistence of dark color and ... thiel volleyballWebTMEM192 Belongs to the TMEM192 family. Strongly expressed in kidney, liver, lung and pancreas. 2 alternatively spliced human isoforms have been reported. ... Molecular Function: protein homodimerization activity: Reference #: Q8IY95 ... TMEM192; Transmembrane protein 192 Gene Symbols: TMEM192 Molecular weight: 30,922 Da Basal ... sainsbury muirend